Sirtuin-1 Inhibits Endothelin-2 Expression in Human Granulosa-Lutein Cells
via HIF1A and Epigenetic Modifications1
Magdalena Szymanska2,6, Sarah Manthe2, Ketan Shrestha2,7, Eliezer Girsh3, Avi Harlev3,4, Tatiana Kisliouk5, and Rina Meidan*2
2Department of Animal Sciences, The Robert H. Smith Faculty of Agriculture, Food and
Environment, The Hebrew University of Jerusalem, Rehovot 7610001, Israel
3Fertility and IVF unit, Barzilai University Medical Center, Ashkelon 7830604, Israel
4Faculty of health sciences, Ben-Gurion University of the Negev, Beer-Sheva 8410501, Israel 5Agricultural Research Organization, Volcani Center, Department of Poultry and Aquaculture Science, Rishon LeZiyyon 7528809, Israel
Funding: This work was supported by the German-Israeli Foundation for Scientific Research and Development (GIF) [project No.: I-1417-201.2/2017], and by the Robert H. Smith Faculty of Agriculture, Food and Environment Research Fund for International Cooperation scholarship.
Present address: Institute of Animal Reproduction and Food Research of the Polish Academy of Sciences, Tuwima 10, 10-748 Olsztyn, Poland.
Present address: Department of Obstetrics and Gynecology, UK Medical Center MS331, University of Kentucky, Lexington, Kentucky 40536, USA.
⦁ Correspondence: Prof. Rina Meidan, Department of Animal Sciences, The Robert H. Smith Faculty of Agriculture, Food and Environment. The Hebrew University of Jerusalem, Rehovot 7610001, Israel; ⦁ [email protected]
© The Author(s) 2020. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: [email protected]
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
Running title: Role of sirtuin-1 in human granulosa-lutein cells.
Summary sentence: Inhibition of EDN2 transcription by SIRT1 is mediated by two plausible mechanisms: lowering HIF1A protein levels and its transcriptional activity and via deacetylation
of histone H3 at the EDN2 promoter, inducing a repressive histone configuration.
Keywords: siRNA silencing; histone modification; HIF1A; EDN2; luteinisation; corpus luteum
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
Abstract
Endothelin-2 (EDN2) expression in granulosa cells was previously shown to be highly dependent on the hypoxic mediator, HIF1A. Here we investigated whether sirtuin-1 (SIRT1), by deacetylating HIF1A and class III histones, modulates EDN2 in human granulosa-lutein cells (hGLCs). We found that HIF1A was markedly suppressed in the presence of resveratrol or aspecific SIRT1 activator, SRT2104. In turn, hypoxia reduced SIRT1 levels, implying a mutuallyinhibitory interaction between hypoxia (HIF1A) and SIRT1. Consistent with reduced HIF1A transcriptional activity, SIRT1 activators, resveratrol, SRT2104, and metformin, each acting via different mechanisms, significantly inhibited EDN2. In support, knockdown of SIRT1 with siRNA markedly elevated EDN2, while adding SRT2104 to SIRT1-silenced cells abolished the stimulatory effect of siSIRT1 on EDN2 levels further demonstrating that EDN2 is negatively correlated with SIRT1. Next, we investigated whether SIRT1 can also mediate the repression of the EDN2 promoter via histone modification. Chromatin immunoprecipitation (ChIP) analysirevealed that SIRT1 is indeed bound to the EDN2 promoter and that elevated SIRT1 induced a40% decrease in the acetylation of histone H3, suggesting that SIRT1 inhibits EDN2 promoteractivity by inducing a repressive histone configuration.
Importantly, SIRT1 activation, usingSRT2104 or resveratrol, decreased the viable numbers of hGLC, and silencing SIRT1 enhancedhGLC viability. This effect may be mediated by reducing HIF1A and EDN2 levels, shown to promote cell survival. Taken together, these findings propose novel, physiologically relevant roles for SIRT1 in downregulating EDN2 and survival of hGLCs.
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
Introduction
Endothelin-2 (EDN2), a small peptide that belongs to the EDN family of pleiotropic peptides [1, 2], has emerged as a crucial player in follicular rupture, ovulation, and corpus luteum (CL)formation [3-5]. EDN2 expression is highly dependent on hypoxia [4, 6]. In fact, hypoxia andthe oxygen sensing molecule – hypoxia inducible factor 1 alpha (HIF1A) – were found to bestrong inducers of EDN2 transcription in granulosa-lutein cells of various species examinedthus far (human, rat, mice, and cows) [4, 7-9]. This relationship is manifested in vivo: HIF1Aand EDN2 are expressed at the same time window during the periovulatory period [4, 7, 10].Hypoxia, an important physiological cue in the CL and other fast-growing tissues,orchestrates the transcriptional activation of numerous other genes related to cell survival and proliferation as well as angiogenesis [4, 7, 11-13]. Hypoxia has a major metabolic effecton the enzymatic activity of sirtuin-1 (SIRT1), by decreasing the NAD+/NADH ratio [11, 14,15]. In fact, an extensive crosstalk between SIRT1, a member of the sirtuin family andHIF1A, was reported [16-19]. SIRT1 is a NAD+-dependent enzyme that deacetylates bothclass III histones and many other proteins including the tumor repressor p53, the forkhead transcription factor, NOS3, and HIF1A [19-23].
Resveratrol, a polyphenol particularly abundant in grape skins and red wine, is commonly used as an SIRT1 activator [24-27]. However, resveratrol has been characterized as a promiscuous molecule; it targets many proteins and acts as an anti-oxidant, anti-inflammatory, and anti-tumor agent [6, 28-30]. Therefore, more selective SIRT1-activating compounds, such as SRT1720 and SRT2104, were developed [31, 32]. Surprisingly, metformin, a commonly prescribed treatment for type 2 diabetes, was recently characterized as another SIRT1 activator that acts by improving SIRT1’s catalytic efficiency when it functions under low NAD+ conditions [33].
Importantly, EDN2 and SIRT1 are colocalized in the granulosa cells (GCs) of various species including humans [24, 25, 34, 35] and cows [4, 11, 36]. Moreover, SIRT1 was found to regulate diverse GC functions, such as proliferation, apoptosis, and secretory activity [25, 27, 37].
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
Here we sought to determine whether SIRT1 affects EDN2 expression, the viability of human GCs, and identify its mechanism of action. To this end, we investigated how SIRT1 manipulation, with exogenous activators and siRNA gene silencing, affects EDN2 and cell viability. Experiments were carried out with primary human granulosa-lutein cells (hGLCs) and non-tumorigenic immortalized hGLCs (designated SVOG cells).
Materials and methods Chemicals
All chemical reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA); the cell culture materials were obtained from Biological Industries (Kibbutz Beit Haemek, Israel), unless otherwise specified.
Culture of primary and immortalized hGLCs
This study was approved by the Institutional Review Board of Barzilai University Medical Center in Ashqelon, Israel (approval 0109-17), and all subjects provided written informed consent. All women were under 35 years of age. Granulosa-lutein cells were obtained from the follicular aspirates of women who were subjected to the long suppression protocol [38] by IVF due to male factor infertility, as previously described [35]. The aspirates were centrifuged (3 min at 3000xg) and erythrocytes were removed using an Ammonium Chloride Potassium (ACK) buffer (0.15 mol/L NH4Cl, 1.0 mmol/L KHCO3, and 0.1 nmol/L EDTA). Additionally, owing to the limited number of primary hGLCs obtained during the isolation procedure, SVOG cells were also used in this study. The SVOG cells were a generous gift from N. Auersperg and P. Leung (University of British Columbia, BC, Canada). These cells were produced by transfecting primary hGLCs with the SV40 large T antigen [39]. They retain the characteristics of the primary cells and have been widely used in several in vitro studies as a granulosa-lutein cell model [9, 13, 34, 40-43]. The cells were cultured in DMEM/F-12 medium containing 10% fetal calf serum (FCS), 2 mM L-glutamine, and 100 mg/mL penicillin/streptomycin.
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
Treatments, i.e., SRT2104 (10–50 µmol/L; Selleck Chemicals, Houston, TX, USA), resveratrol (10–50 µmol/L), and metformin (1000 µmol/L; Selleck Chemicals) were diluted in DMEM/F-12 medium supplemented with 2 mM L-glutamine, 100 mg/mL penicillin/streptomycin, and 1% FCS (basal medium). However, in several experiments, incubation was conducted with a starved culture medium (DMEM/F-12 supplemented with 0.5% FCS and 1% bovine serum albumin).
Cultures were maintained in a humidified incubator under normal oxygen conditions of 21% O2 and 5% CO2 at 37°C. In certain experiments, cells were incubated in a humidified multi-gas chamber under hypoxic conditions of 1% O2, 5% CO2, and 94% N2 (Sanyo, Japan) for 6 or 24 h, as indicated.
SiRNA transfection
Primary hGLCs and SVOG cells were seeded and were transfected with Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) 24 h later at 1% FCS, in accordance with the manufacturer’s protocol, as previously described [34]. Briefly, cells were transfected with 10 nmol/L small interfering RNA (siRNA) constructs (GeneCust, Luxembourg) targeting SIRT1 or with scrambled siRNA (siNC; negative control). The SIRT1 siRNA (siSIRT1) sequences were UAAUCCUGAAAUUCUUAGC[dT][dT] (sense) and GCUAAGAAUUUCAGGAUUA[dT][dT]
(antisense), whereas the siNC sequences were UUCUCCGAACGUGUCACGUTT[dT][dT] (sense) and ACGUGACACGUUCGGAGAATT[dT][dT] (antisense). Approximately 6 hours after transfection, the media were replaced with DMEM/F-12 with 1% FCS or starvation media, as will be detailed later. siSIRT1 transfection reduced SIRT1 mRNA by 75.7 ± 3.3 % and 58.9 ± 2.5 % compared with scrambled siRNA-transfected SVOG cells and hGLCs, respectively.
Cell viability assay
The number of viable cells was determined [4, 44, 45] using the XTT assay kit, which measures the reduction of a tetrazolium component by the mitochondria of viable cells. Each treatment was performed in quadruplicate. On the day of measurement, the media were replaced with fresh DMEM/F-12 medium and XTT solution was added. Measured colorimetrically at a wavelength of 450 nm (reference absorbance, 630 nm), the quantity of the product generated from XTT reduction was proportional to the number of viable cells. The results are presented as a fold change of viable cells relative to the respective control values.
Total RNA isolation and real-time PCR
Total RNA was obtained using the TRI Reagent (Molecular Research Center, Cincinnati, OH, USA) in accordance with the manufacturer’s instructions. Total RNA (1 µg) was reverse transcribed by using the qScript cDNA synthesis kit (Quantabio, Beverly, MA, USA).
Quantitative polymerase chain reaction (qPCR) was performed using the LightCycler 96 system with LightCycler 480 SYBR Green I Master (Roche Diagnostics, Indianapolis, IN, USA), as described previously [4, 45]. To evaluate mRNA levels, the following specific primers were used:forward 5’-
CGCTGGAACAGGTTGCGGGAA-3’ and reverse 5’-
CATCAGCTGGGCACCTAGGAC-3’ for SIRT1 [34], forward 5’-GCCAGCGTCCTCATCTAT-
3’ and reverse 5’- GCCGTAAGGAGCTGTCTGTTC-3’ for EDN2 [9], as well as forward 5’-
CGGGACCTGACGGACTACCTC-3’ and reverse 5’-GCCATCTCCTGCTCGAAGTCC-3’ for actin beta (ACTB) [9].
Primers were developed using Oligo Primer Analysis Software (Molecular Biology Insights, Inc., Colorado Springs, CO, USA), based on the available human sequences; they were designed to span an intron to prevent the amplification of genomic DNA. The threshold cycle (Ct) values of each sample were generated, and the relative abundance of mRNA was calculated as 2-ΔCt=2-(Ct target gene – Ct housekeeping gene) [46 ]. Expression data were normalized against housekeeping ACTB.
Western blot analysis
Total cell lysates were prepared in a sample buffer (x2), separated by 7.5% SDS-PAGE, and subsequently electroblotted to nitrocellulose membranes [4, 34, 45]. After 1 h of blocking with 5% low-fat milk in TBST (Tris-buffered saline mixed with 0.1% Tween 20; pH 7.6), the membranes were incubated overnight at 4 °C with the primary antibodies listed in Table 1. After having been washed with TBST, membranes were incubated with donkey anti-rabbit alkaline peroxidase-conjugated IgG (Table 1) for 1.5 h. Immune complexes were detected by the chemiluminescence procedure using the WESTAR ECL 2.0 kit (Cyanagen, Bologna, Italy) Densitometric quantifications are relative to respective controls and are normalized to the levels of total 44/42 MAPK, used as an internal control for protein loading.
Chromatin immunoprecipitation (ChIP) assay For the ChIP assay, SVOG cells were precultured on cell culture flasks (75 cm2) and when an 80% confluency was reached, the cells were treated with basal medium with or without SRT2104 (50 µmol/L) for 24 h. Then, cells were crosslinked with 1% formaldehyde for 10 min and sonicated in cell lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1) supplemented with a protease inhibitor cocktail (Cell Signalling Technology, Danvers, MA, USA) for 6 rounds of 10 pulses each using a Vibracell (Sonics) sonicator (maximal power 750 W; Sonics & Materials, Inc., Newtown, CT, USA) at 30% maximal power to obtain fragments of 200–1000 bp. Sheared chromatin samples were diluted in a ChIP dilution buffer (0.01% SDS, 1.1% Triton X- 100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, 167 mM NaCl and protease inhibitor cocktail) and incubated overnight at 4 oC with the respective antisera (each 3 µg/sample) listed in Table 1. Normal mouse IgG was used as background IP. Immunoprecipitates (IP) were separated using Magna ChIP Protein A+G magnetic beads (20 μL/sample; Millipore) for 2 h at 4 oC and reverse-crosslinked in ChIP elution buffer [1% SDS, 100 mM NaHCO3, 0.2M NaCl and proteinase K (50 μg/sample)] for 2 h at 62 oC. DNA was isolated from each immunoprecipitate with Simple ChIP DNA Purification Buffers and Spin Columns (Cell Signalling Technology) and subjected to real-time PCR using EDN2 primers aligned at the following positions: −397 to −312 bp upstream of the transcription start site, F‐ CAGAGGGCAGGCAGGATAGAT and R‐ GGGCTGTGAGTGTGGAGGAG. Alpha-ketoglutarate-dependent dioxygenase FTO primers, aligned at position +612 to +711 bp downstream of the transcription start site, and F- TGAAATAGCCGCTGCTTGTG and R- AGCCTTCTCTTTGGCAGCAA were used as negative controls. The data were normalized to respective input controls that consisted of PCRs from 1% crosslinked chromatin before immunoprecipitation.
Statistical analyses
Statistical analyses were performed using GraphPad PRISM v. 6.0 (GraphPad Software, Inc., San Diego, CA, USA). Student’s t-test or one-way ANOVA, followed by the Bonferroni multiple comparison test or two-way ANOVA, followed by the Bonferroni post hoc test, were conducted. Numerical data were presented as the means ± SEM, and the statistical difference was defined as P < 0.05.
Results
Hypoxia and SIRT1 are mutually inhibitory in hGLCs
We initially investigated whether hypoxia (1% O2) regulates SIRT1 in hGLCs; indeed, we found that hypoxia caused a significant decrease in SIRT1 mRNA (~ 30%; Fig. 1A; primary hGLCs) and its protein levels (Fig. 1B; SVOG cells). The reciprocal effect of SIRT1 activators on the hypoxic mediator, HIF1A protein, was then examined. As expected, HIF1A protein was greatly induced by hypoxia, but its levels were markedly inhibited in the presence of resveratrol (Fig. 1C and D) or SRT2104 (Fig. 1E). These results suggest that HIF1A and SIRT1 are mutually inhibitory.
SIRT1-mediated regulation of EDN2 expression in hGLCs
EDN2 expression was reported to be dependent on HIF1A [7, 9]. It was therefore of interest to investigate next whether SIRT1 activators, which inhibit HIF1A (Fig. 1C-E), affect EDN2.
Incubation with the specific SIRT1 activator, SRT2104, led to a dose-dependent inhibition of EDN2 expression in primary hGLCs, exhibiting significant (30% and 50%) reduction at 25 and 50 µmol/L, respectively, at 24 h after treatment (Fig. 2A). The other SIRT1-activating compounds, resveratrol (50 μmol/L) and metformin (MetF; 1000 μmol/L), shown to increase
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
SIRT1 expression (Fig. 2B) also significantly inhibited EDN2 levels after 24 h of incubation (36% and 32% reduction, respectively), compared with cells cultured in basal medium; Fig. 2C.SIRT1 levels are high in human GCs [34]. Hence, to further substantiate the role of SIRT1 in these cells, its endogenous expression was silenced with siRNA constructs. Transfection of SVOG cells with SIRT1 siRNA efficiently silenced SIRT1 (~70% decrease 48 h post- transfection). Furthermore, the stimulatory effects of 50 µmol/L SRT2104 on SIRT1 mRNA (Fig. 3A) observed in siNC (scrambled siRNA)-transfected cells were also eliminated with SIRT1 silencing. Consistent with mRNA levels, SIRT1 protein levels dropped in SIRT1-silenced SVOG cells incubated under basal conditions as well as in cells incubated in the presence of SRT2104 (Figs. 3B and S1). In non-silenced cells, the protein levels of SIRT1 were also stimulated by SRT2104 as we previously showed [34]. Importantly, the expression of EDN2 in silenced cells was inversely correlated with SIRT1, where knockdown of SIRT1 markedly elevated EDN2, while the addition of SRT2104 to SIRT1-silenced cells abolished this stimulatory effect (Fig. 3C). These results are in good agreement with those presented in Fig. 2, depicting the inhibitory effect of SRT2104 in non-transfected cells.
Pronounced SIRT1 silencing was evident from 24 to 72 h post-transfection, with only a slight elevation of its levels at 72 h, compared to those found at 24 h (Fig. 4A). Concomitantly with SIRT1 silencing, EDN2 was significantly elevated; however, this effect became obvious from 48h onwards; there was a 1.5-fold increase at 48 h and a further 2.3-fold increase at 72 h, compared with the respective time controls (Fig. 4B). The delayed EDN2 response to silencing (Figs. 3 and 4), compared with the exogenous SIRT1 activation (Fig. 2), may reflect the time needed to reduce high intrinsic SIRT1 protein.
Given that SIRT1 is a member of the class III histone deacetylase family [15, 47, 48] and that its
siRNA silencing stimulates EDN2 expression in SVOG cells, it was of interest to investigate next whether SIRT1 was associated with the EDN2 promoter and whether it was able to mediate the inhibition of the EDN2 gene expression via histone deacetylation. To this end, a ChIP assay was performed with a specific SIRT1 antibody (IP-SIRT1), followed by qPCR of the EDN2 promoter region. As the results in Fig. 5A reveal, SIRT1 is associated with the EDN2 promoter in SRT2104-stimulated SVOG cells roughly twice as much as with the basal untreated cells.
Furthermore, ChIP analysis of the same promoter region in SRT2104-treated cells with anti‐ acetyl histone H3 antibody (IP-H3 acetyl) revealed that an elevated SIRT1 level at the EDN2 promoter was accompanied by a 40% decrease in the acetylation of histone H3 (P < 0.01; Fig. 5B), most likely reflecting SIRT1-dependent H3 deacetylation at the EDN2 promoter. There were no significant changes found between the association of SIRT1 and FTO (a control gene) or the H3 acetylation levels between basal and SIRT1-activating cells. Immunoprecipitation with normal mouse IgG (IP-IgG) was used as the background (Fig. 5). These results suggest that SIRT1 generates a repressive histone configuration at the EDN2 promoter to hamper EDN2 transcription.
Effect of SIRT1 on granulosa cell viability
To further investigate the physiological relevance of SIRT1 in human GCs, we determined its effect on cell viability. Fibroblast growth factor 2 (10 µg/mL) and FCS (10%), used as positive controls for primary hGLCs and SVOG cells, showed the expected increase in cell numbers (data not shown). Figure 6A shows data on the dose-dependent inhibition of viable SVOG cell numbers as a result of SRT2104 or resveratrol treatment for 48 h. Both compounds produced the maximal inhibitory effects of 47% and 53% reduction at 50 µmol/L for SRT2104 and resveratrol, respectively, compared with basal levels. A similar inhibitory effect was noted in primary hGLCs following SRT2104 treatment, with a twofold decrease in cell viability at 50 µmol/L (Fig. 6B). These results were corroborated with SIRT1 silencing, showing that SIRT1 ablation (Fig. 6C) was accompanied by a significant increase in the number of viable primary hGLCs (Fig. 6D).
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
Discussion
This study examined the biological functions of SIRT1 in human luteinized granulosa cells, highlighting its novel role in suppressing the expression of EDN2. The findings presented here suggest that SIRT1 inhibits the expression of EDN2 by inducing repressive epigenetic modifications of the EDN2 promoter. Diminishing HIF1A levels by SIRT1 shown here may
reduce its transcriptional activity exerted via hypoxia response element (HRE). It also shows that SIRT1 activators negatively regulate the survival of hGLCs. For both EDN2 and cell viability, siRNA silencing of endogenous SIRT1 corroborated the effects observed with SIRT1 activators (depicted in the graphical abstract).
Activating SIRT1 via discrete mechanism, SRT2104, resveratrol, and metformin [33, 49-51established that hypoxia, via HIF1A, is a major inducer of EDN2 in GCs of various species [4, 8, 9, 13]. Low oxygen levels (1% O2) or CoCl2-hypoxia mimetic led to the simultaneous elevation of HIF1A [12, 52] and EDN2 [4, 8, 13]. Moreover, HIF1A knockdown with specific siRNA abolished hypoxia-induced EDN2 in GCs, thus confirming that EDN2 is a HIF1A-responsive gene [7, 13,
53].
Accordingly, a putative HRE was identified in human EDN2 promoter [9]. Nevertheless, the relationship between SIRT1 and HRE activation of EDN2 promoter is warrant future investigation. Our previous studies showed that HIF1A regulates EDN2 via the hypoxiamiR, miR-210. Its elevation increased EDN2 in hGLCs and its inhibition via anti miR-210 reduced EDN2 expression, even in the presence of CoCl2, indicating the importance of this miR-210 in the hypoxic induction of EDN2. Finally, a molecule that destabilizes HIF1A protein, glycerol-3- phosphate dehydrogenase 1-like, was established as a miR-210 target [9].
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
Here we observed that SIRT1 activation by resveratrol or SRT2104 markedly suppressed HIF1A under hypoxia. HIF1A was computationally predicted and experimentally validated to be a target for SIRT1 deacetylase activity [16-19]. However, previous studies examining the regulation of HIF1A by SIRT1 appear to be contradictory and SIRT1 has been found to be both a positive and a negative regulator of HIF1A [16-18]. Lim et al. [18] showed that SIRT1 mediates the hypoxic and normoxic inactivation of HIF1A by its deacetylation at Lys674 and consequently represses HIF1A-responsive genes. Our findings are consistent with those of Limet al. [18], demonstrating that SIRT1 activators, namely, resveratrol and SRT2104, inhibit HIF1Aprotein (observed under hypoxia) and its target gene, EDN2, in hGLCs. Our results also showed that hypoxia significantly reduces SIRT1 mRNA and protein levels in hGLCs. This may have occurred as a result of reduced NAD+ levels under hypoxic conditions, as suggested before [18, 54, 55]. Together, these findings suggest that hypoxia and SIRT1 are mutually inhibitory in hGLCs.
Both HIF1A and EDN2 are transiently expressed during the periovulatory period [4, 7, 52]. Although it was well established that LH/hCG and hypoxia together enhance HIF1A protein and EDN2 transcripts [9, 13], the mechanisms that curtail their expression are much less defined.
The findings of the current study suggest that SIRT1 may be responsible for downregulating both HIF1A and EDN2. Among their diverse functions, HIF1A and EDN2 were shown to promote cell survival [4, 11, 56]. Maintaining HIF1A protein and EDN2 levels for a short period of time may be responsible for the short CL growth phase, which is followed by differentiation, unlike many tumors that convey these two factors [57-59].
SIRT1 may also suppress gene transcription at the chromatin level, as reported for claudin-1, clock-controlled genes, or Kisspeptin1 (Kiss1), via direct deacetylation of specific lysine residues of histones, preferentially histone H3 [15, 48, 60-62]. Vazquez et al. [48] showed that increased SIRT1 content within the Kiss1 promoter was accompanied by a decreased abundance of acetylated histone marks, H3K9ac and H3K4me, which inhibited Kiss1 expression in mouse Neuro2A cells. The epigenetic markers regulating the expression of EDN2 have previously been poorly studied. The current study infers that SIRT1 deacetylates histone H3 at the EDN2 promoter, resulting in a repressive histone configuration. Increased recruitment of SIRT1 protein to the EDN2 promoter led to a lower acetyl-Histone H3 level.
This effect, together with reduced HIF1A, indicates that SIRT1 suppresses EDN2 expression by modulating its promoter activity.Another physiologically significant action of SIRT1 observed here is its effect on cell viability. SIRT1 activation, using SRT2104 or resveratrol, significantly decreased the number of viable hGLCs; accordingly, silencing endogenous SIRT1 enhanced primary hGLC viability. It is also interesting that transformed and primary hGLCs responded similarly to activators in terms of cell viability (this study) and SIRT1 induction reported recently [34]. This further
confirms that SVOG cells are a reliable model for granulosa-lutein cells. To the best of our knowledge, the effect of SIRT1 on the survival of human GCs has not yet been examined. Additional research is necessary to determine whether the changes induced by a specific SIRT1 activator on the human GC viability observed here result from decreased proliferation or increased apoptosis. Previous studies investigated the effects of the non-selective SIRTactivator, resveratrol, on the proliferation/survival of GCs in various animals (mice, cattle, and pigs). These studies reported inconsistent results, showing both proliferative and apoptotic actions of resveratrol [25, 27, 37, 63]. This controversy may result from a species difference or more likely, from a different developmental stage of GCs utilized in these studies.
The fact that SIRT1 inhibited GC viability is in line with its inhibition of HIF1A and EDN2, shown to promote cell survival [4, 11, 56]. This suggests the existence of the SIRT1/HIF1A/EDN2 autocrine loop regulating GC survival. In vivo, the proliferation index of GCs decreases during luteinization [64-68]; this is achieved because LH induces GCs of periovulatory follicles to exit the cell cycle [67, 69]. Our in vitro data may extend these observations: cAMP elevating agents Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020 stimulate SIRT1 levels [34] and SIRT1, which then inhibits the proliferation of hGLCs (this study). This suggests that SIRT1 may contribute to gonadotropins’ action in the suppression of GC proliferation and may promote their final differentiation [70, 71].Taken together, these findings propose novel, physiologically relevant roles for SIRT1 in downregulating EDN2 and the survival of human GCs approaching ovulation.
Acknowledgments
The authors are grateful to the German-Israeli Foundation for Scientific Research and Development for funding this work and to the International School of Agricultural Sciences, The Robert H. Smith Faculty of Agriculture, Food and Environment for providing a fellowship to M. Szymanska. We are also thankful to Prof. N. Auersperg of the University of British Columbia for the generous gift of SVOG cells.
Conflict of interest
The authors declared no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Author contributions
MS participated in study design, experimentation, data analysis, interpretation of data, and manuscript drafting. SM and KS participated in the study design, experimentation, data analysis, and manuscript revision. EG and AH prepared the documents for the ethics committee, allocated the women, collected clinical samples, and participated in manuscript revision. TK performed ChIP analyses and participated in manuscript revision. RM secured funding, contributed to the study design, critical discussion, and manuscript writing.
Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
References
1. Arinami T, Ishikawa M, Inoue A, Yanagisawa M, Masaki T, Yoshida MC, Hamaguchi
H. Chromosomal assignments of the human endothelin family genes: the endothelin- 1 gene (EDN1) to 6p23-p24, the endothelin-2 gene (EDN2) to 1p34, and the endothelin-3 gene (EDN3) to 20q13.2-q13.3. Am J Hum Genet 1991; 48:990-996.
2. Inoue A, Yanagisawa M, Kimura S, Kasuya Y, Miyauchi T, Goto K, Masaki T. The human endothelin family: three structurally and pharmacologically distinct isopeptides predicted by three separate genes. Proc Natl Acad Sci U S A 1989; 86:2863-2867.
3. Cacioppo J, Oh S, Kim H, Cho J, Lin P, Yanagisawa M, Ko C. Loss of function of endothelin-2 leads to reduced ovulation and CL formation. PLoS ONE 2014; 9:e96115.
4. Klipper E, Levit A, Mastich Y, Berisha B, Schams D, Meidan R. Induction of endothelin-2 expression by luteinizing hormone and hypoxia: possible role in bovine corpus luteum formation. Endocrinology 2010; 151:1914-1922.
5. Palanisamy G, Cheon Y, Kim J, Kannan A, Li Q, Sato M, Mantena S, Sitruk-Ware R, Bagchi M, Bagchi I. A novel pathway involving progesterone receptor, endothelin-2, and endothelin receptor B controls ovulation in mice. Molecular Endocrinology 2006; 20:2784-2795.
6. Ko C, Gieske MC, Al-Alem L, Hahn Y, Su W, Gong MC, Iglarz M, Koo Y. Endothelin- 2 in ovarian follicle rupture. Endocrinology 2006; 147:1770-1779.
7. Kim J, Bagchi IC, Bagchi MK. Signaling by hypoxia-inducible factors is critical for ovulation in mice. Endocrinology 2009; 150:3392-3400.
8. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Na G, Bridges PJ, Koo Y, Ko C. Role of hypoxia in the regulation of periovulatory EDN2 expression in the mouse. Can J Physiol Pharmacol 2008; 86:310-319.
9. Shrestha K, Onasanya AE, Eisenberg I, Wigoda N, Yagel S, Yalu R, Meidan R, Imbar T. miR-210 and GPD1L regulate EDN2 in primary and immortalized human granulosa-lutein cells. Reproduction 2018; 155:197-205.
10. Choi DH, Kim EK, Kim KH, Lee KA, Kang DW, Kim HY, Bridges P, Ko C. Expression pattern of endothelin system components and localization of smooth muscle cells in the human pre-ovulatory follicle. Hum Reprod 2011; 26:1171-1180.
11. Shiratsuki S, Hara T, Munakata Y, Shirasuna K, Kuwayama T, Iwata H. Low oxygen level increases proliferation and metabolic changes in bovine granulosa cells. Mol Cell Endocrinol 2016; 437:75-85.
12. Tam KK, Russell DL, Peet DJ, Bracken CP, Rodgers RJ, Thompson JG, Kind KL. Hormonally regulated follicle differentiation and luteinization in the mouse is associated with hypoxia inducible factor activity. Mol Cell Endocrinol 2010; 327:47- 55.
13. Yalu R, Oyesiji AE, Eisenberg I, Imbar T, Meidan R. HIF1A-dependent increase in endothelin 2 levels in granulosa cells: role of hypoxia, LH/cAMP, and reactive oxygen species. Reproduction 2015; 149:11-20.
14. Finkel T, Deng CX, Mostoslavsky R. Recent progress in the biology and physiology of sirtuins. Nature 2009; 460:587-591.
15. Imai S, Armstrong CM, Kaeberlein M, Guarente L. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 2000; 403:795-800.
16. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Joo HY, Yun M, Jeong J, Park ER, Shin HJ, Woo SR, Jung JK, Kim YM, Park JJ, Kim J, Lee KH. SIRT1 deacetylates and stabilizes hypoxia-inducible factor-1alpha (HIF-1alpha) via direct interactions during hypoxia. Biochem Biophys Res Commun 2015; 462:294-300.
17. Laemmle A, Lechleiter A, Roh V, Schwarz C, Portmann S, Furer C, Keogh A, Tschan MP, Candinas D, Vorburger SA, Stroka D. Inhibition of SIRT1 impairs the accumulation and transcriptional activity of HIF-1alpha protein under hypoxic conditions. PLoS One 2012; 7:e33433.
18. Lim JH, Lee YM, Chun YS, Chen J, Kim JE, Park JW. Sirtuin 1 modulates cellular responses to hypoxia by deacetylating hypoxia-inducible factor 1alpha. Mol Cell 2010; 38:864-878.
19. Zhai Z, Tang M, Yang Y, Lu M, Zhu WG, Li T. Identifying Human SIRT1 Substrates by Integrating Heterogeneous Information from Various Sources. Sci Rep 2017; 7:4614.
20. Luo J, Nikolaev AY, Imai S, Chen D, Su F, Shiloh A, Guarente L, Gu W. Negative control of p53 by Sir2alpha promotes cell survival under stress. Cell 2001; 107:137- 148.
21. Vaziri H, Dessain SK, Ng Eaton E, Imai SI, Frye RA, Pandita TK, Guarente L, Weinberg RA. hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell 2001; 107:149-159.
22. Motta MC, Divecha N, Lemieux M, Kamel C, Chen D, Gu W, Bultsma Y, McBurney M, Guarente L. Mammalian SIRT1 represses forkhead transcription factors. Cell 2004; 116:551-563.
23. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Xia N, Strand S, Schlufter F, Siuda D, Reifenberg G, Kleinert H, Forstermann U, Li H. Role of SIRT1 and FOXO factors in eNOS transcriptional activation by resveratrol. Nitric Oxide 2013; 32:29-35.
24. Han Y, Luo H, Wang H, Cai J, Zhang Y. SIRT1 induces resistance to apoptosis in human granulosa cells by activating the ERK pathway and inhibiting NF-kappaB signaling with anti-inflammatory functions. Apoptosis 2017; 22:1260-1272.
25. Morita Y, Wada-Hiraike O, Yano T, Shirane A, Hirano M, Hiraike H, Koyama S, Oishi H, Yoshino O, Miyamoto Y, Sone K, Oda K, et al. Resveratrol promotes expression of SIRT1 and StAR in rat ovarian granulosa cells: an implicative role of SIRT1 in the ovary. Reprod Biol Endocrinol 2012; 10:14.
26. Signorelli P, Ghidoni R. Resveratrol as an anticancer nutrient: molecular basis, open questions and promises. J Nutr Biochem 2005; 16:449-466.
27. Sirotkin A, Alexa R, Kadasi A, Adamcova E, Alwasel S, Harrath AH. Resveratrol directly affects ovarian cell sirtuin, proliferation, apoptosis, hormone release and response to follicle-stimulating hormone (FSH) and insulin-like growth factor I (IGF-I). Reprod Fertil Dev 2019; 31:1378-1385.
28. Kao CL, Chen LK, Chang YL, Yung MC, Hsu CC, Chen YC, Lo WL, Chen SJ, Ku HH, Hwang SJ. Resveratrol protects human endothelium from H(2)O(2)-induced oxidative stress and senescence via SirT1 activation. J Atheroscler Thromb 2010; 17:970-979.
29. Sadeghi A, Seyyed Ebrahimi SS, Golestani A, Meshkani R. Resveratrol Ameliorates Palmitate-Induced Inflammation in Skeletal Muscle Cells by Attenuating Oxidative Stress and JNK/NF-kappaB Pathway in a SIRT1-Independent Mechanism. J Cell Biochem 2017; 118:2654-2663.
30. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Sanchez-Fidalgo S, Cardeno A, Villegas I, Talero E, de la Lastra CA. Dietary supplementation of resveratrol attenuates chronic colonic inflammation in mice. Eur J Pharmacol 2010; 633:78-84.
31. Camins A, Sureda FX, Junyent F, Verdaguer E, Folch J, Pelegri C, Vilaplana J, Beas-Zarate C, Pallas M. Sirtuin activators: designing molecules to extend life span. Biochim Biophys Acta 2010; 1799:740-749.
32. Milne JC, Lambert PD, Schenk S, Carney DP, Smith JJ, Gagne DJ, Jin L, Boss O, Perni RB, Vu CB, Bemis JE, Xie R, et al. Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes. Nature 2007; 450:712-716.
33. Cuyas E, Verdura S, Llorach-Pares L, Fernandez-Arroyo S, Joven J, Martin-Castillo B, Bosch-Barrera J, Brunet J, Nonell-Canals A, Sanchez-Martinez M, Menendez JA. Metformin Is a Direct SIRT1-Activating Compound: Computational Modeling and Experimental Validation. Front Endocrinol (Lausanne) 2018; 9:657.
34. Szymanska M, Manthe S, Shrestha K, Girsh E, Harlev A, Meidan R. The cAMP pathway promotes sirtuin-1 expression in human granulosa-lutein cells. Reprod Biol 2020; 20:273-281.
35. Imbar T, Klipper E, Greenfield C, Hurwitz A, Haimov-Kochman R, Meidan R. Altered endothelin expression in granulosa-lutein cells of women with polycystic ovary syndrome. Life Sci 2012; 91:703-709.
36. Wang F, Tian X, Zhang L, He C, Ji P, Li Y, Tan D, Liu G. Beneficial effect of resveratrol on bovine oocyte maturation and subsequent embryonic development after in vitro fertilization. Fertil Steril 2014; 101:577-586.
37. Tan XW, You W, Song EL, Zhao HB, Liu XM, Wang HZ, Liu GF, Cheng HJ, Liu YF, Wan FC. Effect of SIRT1 on cellular apoptosis and steroidogenesis in bovine ovarian granulosa cells in vitro. Livestock Science 2015; 180:257-262.
38. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Fleming R, Haxton MJ, Hamilton MP, Conaghan CJ, Black WP, Yates RW, Coutts JR. Combined gonadotropin-releasing hormone analog and exogenous gonadotropins for ovulation induction in infertile women: efficacy related to ovarian function assessment. Am J Obstet Gynecol 1988; 159:376-381.
39. Lie BL, Leung E, Leung PC, Auersperg N. Long-term growth and steroidogenic potential of human granulosa-lutein cells immortalized with SV40 large T antigen. Mol Cell Endocrinol 1996; 120:169-176.
40. Chang HM, Cheng JC, Huang HF, Shi FT, Leung PC. Activin A, B and AB decrease progesterone production by down-regulating StAR in human granulosa cells. Mol Cell Endocrinol 2015; 412:290-301.
41. Fang Y, Chang HM, Cheng JC, Klausen C, Leung PC, Yang X. Transforming growth factor-beta1 increases lysyl oxidase expression by downregulating MIR29A in human granulosa lutein cells. Reproduction 2016; 152:205-213.
42. Chen YC, Chang HM, Cheng JC, Tsai HD, Wu CH, Leung PC. Transforming growth factor-beta1 up-regulates connexin43 expression in human granulosa cells. Hum Reprod 2015; 30:2190-2201.
43. Bai L, Chang HM, Cheng JC, Chu G, Leung PCK, Yang G. Lithium Chloride Increases COX-2 Expression and PGE2 Production in a Human Granulosa-Lutein SVOG Cell Line Via a GSK-3beta/beta-Catenin Signaling Pathway. Endocrinology 2017; 158:2813-2825.
44. Farberov S, Meidan R. Functions and transcriptional regulation of thrombospondins and their interrelationship with fibroblast growth factor-2 in bovine luteal cells. Biol Reprod 2014; 91:58.
45. Shrestha K, Meidan R. The cAMP-EPAC Pathway Mediates PGE2-Induced FGF2 in Bovine Granulosa Cells. Endocrinology 2018; 159:3482-3491.
46. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25:402-408.
47. Vaquero A, Scher M, Lee D, Erdjument-Bromage H, Tempst P, Reinberg D. Human SirT1 interacts with histone H1 and promotes formation of facultative heterochromatin. Mol Cell 2004; 16:93-105.
48. Vazquez MJ, Toro CA, Castellano JM, Ruiz-Pino F, Roa J, Beiroa D, Heras V, Velasco I, Dieguez C, Pinilla L, Gaytan F, Nogueiras R, et al. SIRT1 mediates obesity- and nutrient-dependent perturbation of pubertal timing by epigenetically controlling Kiss1 expression. Nat Commun 2018; 9:4194.
49. Park SJ, Ahmad F, Um JH, Brown AL, Xu X, Kang H, Ke H, Feng X, Ryall J, Philp A, Schenk S, Kim MK, et al. Specific Sirt1 Activator-mediated Improvement in Glucose Homeostasis Requires Sirt1-Independent Activation of AMPK. EBioMedicine 2017; 18:128-138.
50. Hubbard BP, Gomes AP, Dai H, Li J, Case AW, Considine T, Riera TV, Lee JE, E SY, Lamming DW, Pentelute BL, Schuman ER, et al. Evidence for a common mechanism of SIRT1 regulation by allosteric activators. Science 2013; 339:1216- 1219.
51. Schultz MB, Rinaldi C, Lu Y, Amorim JA, Sinclair DA. Molecular and Cellular Characterization of SIRT1 Allosteric Activators. Methods Mol Biol 2019; 1983:133- 149.
52. van den Driesche S, Myers M, Gay E, Thong K, Duncan W. HCG up-regulates hypoxia inducible factor-1 alpha in luteinized granulosa cells: implications for the hormonal regulation of vascular endothelial growth factor A in the human corpus luteum. Molecular Human Reproduction 2008; 14:455-464.
53. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Zhang J, Zhang Z, Wu Y, Chen L, Luo Q, Chen J, Huang X, Cheng Y, Wang Z. Regulatory effect of hypoxia-inducible factor-1alpha on hCG-stimulated endothelin-2 expression in granulosa cells from the PMSG-treated rat ovary. J Reprod Dev 2012; 58:678-684.
54. Zhang Q, Wang SY, Fleuriel C, Leprince D, Rocheleau JV, Piston DW, Goodman RH. Metabolic regulation of SIRT1 transcription via a HIC1:CtBP corepressor complex. Proc Natl Acad Sci U S A 2007; 104:829-833.
55. Zhang Q, Wang SY, Nottke AC, Rocheleau JV, Piston DW, Goodman RH. Redox sensor CtBP mediates hypoxia-induced tumor cell migration. Proc Natl Acad Sci U S A 2006; 103:9029-9033.
56. Hubbi ME, Semenza GL. Regulation of cell proliferation by hypoxia-inducible factors.
Am J Physiol Cell Physiol 2015; 309:C775-782.
57. Ling L, Maguire JJ, Davenport AP. Endothelin-2, the forgotten isoform: emerging role in the cardiovascular system, ovarian development, immunology and cancer. Br J Pharmacol 2013; 168:283-295.
58. Paolicchi E, Gemignani F, Krstic-Demonacos M, Dedhar S, Mutti L, Landi S. Targeting hypoxic response for cancer therapy. Oncotarget 2016; 7:13464-13478.
59. Schito L, Semenza GL. Hypoxia-Inducible Factors: Master Regulators of Cancer Progression. Trends Cancer 2016; 2:758-770.
60. Hasegawa K, Wakino S, Simic P, Sakamaki Y, Minakuchi H, Fujimura K, Hosoya K, Komatsu M, Kaneko Y, Kanda T, Kubota E, Tokuyama H, et al. Renal tubular Sirt1 attenuates diabetic albuminuria by epigenetically suppressing Claudin-1 overexpression in podocytes. Nat Med 2013; 19:1496-1504.
61. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Nakahata Y, Kaluzova M, Grimaldi B, Sahar S, Hirayama J, Chen D, Guarente LP, Sassone-Corsi P. The NAD+-dependent deacetylase SIRT1 modulates CLOCK- mediated chromatin remodeling and circadian control. Cell 2008; 134:329-340.
62. Fusco S, Maulucci G, Pani G. Sirt1: def-eating senescence? Cell Cycle 2012; 11:4135-4146.
63. Ortega I, Wong DH, Villanueva JA, Cress AB, Sokalska A, Stanley SD, Duleba AJ. Effects of resveratrol on growth and function of rat ovarian granulosa cells. Fertil Steril 2012; 98:1563-1573.
64. Robker RL, Richards JS. Hormonal control of the cell cycle in ovarian cells: proliferation versus differentiation. Biol Reprod 1998; 59:476-482.
65. Green C, Chatterjee R, McGarrigle HH, Ahmed F, Thomas NS. p107 is active in the nucleolus in non-dividing human granulosa lutein cells. J Mol Endocrinol 2000; 25:275-286.
66. Chaffkin LM, Luciano AA, Peluso JJ. Progesterone as an autocrine/paracrine regulator of human granulosa cell proliferation. J Clin Endocrinol Metab 1992; 75:1404-1408.
67. Stocco C, Telleria C, Gibori G. The molecular control of corpus luteum formation, function, and regression. Endocr Rev 2007; 28:117-149.
68. Chaffkin LM, Luciano AA, Peluso JJ. The role of progesterone in regulating human granulosa cell proliferation and differentiation in vitro. J Clin Endocrinol Metab 1993; 76:696-700.
69. Chaffin CL, Schwinof KM, Stouffer RL. Gonadotropin and steroid control of SRT2104 granulosa cell proliferation during the periovulatory interval in rhesus monkeys. Biol Reprod 2001; 65:755-762.
70. Downloaded from https://academic.oup.com/biolreprod/advance-article/doi/10.1093/biolre/ioaa199/5941972 by University of Glasgow user on 31 October 2020
1.
1. Murphy BD. Models of luteinization. Biol Reprod 2000; 63:2-11.
71. Wissing ML, Kristensen SG, Andersen CY, Mikkelsen AL, Host T, Borup R, Grondahl ML. Identification of new ovulation-related genes in humans by comparing the transcriptome of granulosa cells before and after ovulation triggering in the same controlled ovarian stimulation cycle. Hum Reprod 2014; 29:997-1010.